Career Profile

I apply bioinformatics principles to public health and would like to continue in this avenue. This has led to exciting applications such as genomic epidemiology for bacterial pathogens.

Experiences

LOCUS       DFWED, CDC  1000bp  DNA  2014 - present 
DEFINITION  Working as Senior bioinformatician 
FEATURES             Location/Qualifiers
     source          1..10
                     /organism="Homo sapiens"
     CDS             1..10
                     /product="Genomics of Food Safety group 
(Gen-FS) " CDS 1..10 /product="Global Microbial Identifier (GMI). "
ORIGIN TAGCTAACTGACCGTCAGTTAGCTA //
LOCUS BioMe, EDLB 1000bp DNA 2015 - present DEFINITION Working as Senior bioinformatician FEATURES Location/Qualifiers source 1..10 /organism="Homo sapiens" CDS 1..10 /product="Senior bioinformatician for the Enteric
Diseases Laboratory Branch "
ORIGIN TAGCTAACTGACCGTCAGTTAGCTA //
LOCUS CDC 1000bp DNA August 2020 - April 2021 DEFINITION Working as COVID-19 response, CDC FEATURES Location/Qualifiers source 1..10 /organism="Homo sapiens" CDS 1..10 /product="DFWED/NWSS/tiger team (Oct 2021 -
Dec 2021) " CDS 1..10 /product="Team lead, Technical Outreach and
Assistances to States Team (TOAST)
- Jan 2021-April 2021 " CDS 1..10 /product="QA/QC for WGS in the
SneakerNet SARS-CoV-2 workflow " CDS 1..10 /product="Clinical Team, supervisors Drs. Karen
Wong and James Lee; August
- October 2020 "
ORIGIN TAGCTAACTGACCGTCAGTTAGCTA //
LOCUS LYVE Lab 1000bp DNA 2011 - 2015 DEFINITION Working as Senior bioinformatician in Lyve Lab FEATURES Location/Qualifiers source 1..10 /organism="Homo sapiens" CDS 1..10 /product="bioinformatician for Vibrio and Listeria
" CDS 1..10 /product="Real time genomic epidemiology of
Listeria " CDS 1..10 /product="Computational genomics of Vibrio " CDS 1..10 /product="Computational genomics of STEC " CDS 1..10 /product="Metagenomics of stool "
ORIGIN TAGCTAACTGACCGTCAGTTAGCTA //
LOCUS Meningitis Lab 1000bp DNA 2010 - 2011 DEFINITION Working as Bioinformatician FEATURES Location/Qualifiers source 1..10 /organism="Homo sapiens" CDS 1..10 /product="Bioinformatician in Meningitis Lab "
ORIGIN TAGCTAACTGACCGTCAGTTAGCTA //
LOCUS GA Institute of Technology 1000bp DNA 2006 - 2010 DEFINITION Working as PhD Candidate FEATURES Location/Qualifiers source 1..10 /organism="Homo sapiens" CDS 1..10 /product="collaboration with Meningitis and Vaccine
Preventable Diseases Branch at CDC
" CDS 1..10 /product="Meningococcus Genome Informatics Platform developer
" CDS 1..10 /product="cichlid evolution research "
ORIGIN TAGCTAACTGACCGTCAGTTAGCTA //
LOCUS GA Institute of Technology 1000bp DNA 2004 - 2005 DEFINITION Working as MS Student FEATURES Location/Qualifiers source 1..10 /organism="Homo sapiens" CDS 1..10 /product="Graduate student with courses " CDS 1..10 /product="Studied microRNA "
ORIGIN TAGCTAACTGACCGTCAGTTAGCTA //

Chairing and awards

These are a list of activities that I host or help host, and awards/grants that I have earned

ASM NGS Hackathon, organizer and chair (2020)
  • Objective: to create continuous integration on bioinformatics software.
  • Organized about 20 participants around the ASM NGS conference.
  • Invited and hosted a keynote speaker.
  • Created an environment on Zoom and Discord.
  • The hackathon is resulting in a publication for recommendations in bioinformatics software testing. This is in preparation: Putten et al, MBio.
Microbinfie virtual lab conference co-facilitator and co-chair
  • Created a conference to absorb bioinformatics talks that were canceled due to the pandemic
  • Equal partners in facilitating, organizing, etc, with Dr. Nabil-Fareed Alikhan
  • Facilitated 12 talks over four weeks
  • Facilitated a happy hour with a trivia night
Microbinfie virtual lab talks co-facilitator and co-chair (2019 - 2020)

Hosted a virtual lab talk once a month and recorded the talks. Each talk is 15 or 20 minutes plus Q&A, for a total of 1-hour sessions.

Microbinfie podcast host (2019 -)
  • Podcast discusses topics in the intersection of bioinformatics and public health
  • Co-host with Drs. Andrew Page and Nabil-Fareed Alikhan
  • Record podcast on Zoom
  • Edit audio on Audacity and/or Descript
  • Release an episode of 20-40 minutes every two weeks
  • Always a relevant bioinformatics topic
  • Some episodes have guests; some are panel discussions at conferences
  • About 30k cumulative listens as of 2021-10-13
    • Most played episode is at 1.1k
    • About 460 “listens” per episode
    • Least listened episode is at 330
    • Reaches at least 50 countries of at least 10 listens each
Microbial bioinformatics forum administrator (September 2016 -)
  • This workspace represents a new generation of international microbial bioinformaticians, with direct links to peers in all international major public health services, public health institutions, and affiliated universities.
  • I developed a code of conduct for the forum, which describes actions not permitted, and actions that the administrators can take when there is a violation.
  • The purpose is strictly not a help desk but is a place to get help directly from the source, e.g., understanding undocumented workflows or putting forth ideas directly with the author of a software package.
Spaceball1 computer for DFWED/MCT-DART (2020)

Received an FIA (Fund If Available) for a 192-thread computer lovingly named Spaceball1. $80k

  • hosted in scicomp
  • 1.5 TB RAM, 192 threads, 6T fast scratch space
  • I am the point of contact
  • Saves the division money by obviating any local scientific workstations
  • More powerful than virtually all other computers at CDC
Seed grant, Center for Food Safety, University of GA (2019)

To develop the Mashpit genomic epidemiology platform. Collaborators are Xiangyu Deng and Henk Den Bakker. ($30k)

Seed grant, Center for Food Safety, University of GA (2018)

To develop the Kalamari metagenomics database. Collaborators are Xiangyu Deng and Henk Den Bakker. ($30k)

Emerging Leadership Certificate Program (June 2018 - Oct 2018)
  • Learning skills for leadership including interpersonal, leadership, and communication skills.
    • Several classes June 2018 - Oct 2018
    • The next level: powering your potential
    • Decision mojo
    • Strategic thinking
    • Think like a leader and collaborate between groups
    • The art of communication
    • Build a powerful professional brand
  • 360 review - 6 colleagues gave feedback on how I am in the workplace
  • Major project, completed Oct 2018. Created a plan along with four others in my cohort to create a career counselor professional at CDC, career days, and improvements on the trainings intranet site.
Nakano Citation, NCEZID/CDC (2017)

For one of the best laboratory papers of 2017 in the NCEZID center in CDC (Lyve-SET paper)

Shepard award nomination, CDC (2017)

For best laboratory manuscript

CDC award (2015)

For the Listeria whole genome sequencing project

NCEZID award (2015)

For the Listeria whole genome sequencing project

HHS Innovates Secretary's Pick award (2014)

For a project in The Department of Health and Human Services which shows innovation to solve important challenges in the workplace. The Secretary of HHS chose the project herself. This award was given for the Listeria project Whole Genome Sequencing Future of Food Safety.

Nakano Citation (2014)

For one of the best papers of 2013 in the NCEZID center in CDC. The paper was the Haiti cholera paper.

Shepard Award 2014 nomination (2013)

For best paper at CDC under the laboratory science category, namely the Haiti cholera work

Breakfast with the Director (2012)

A select few from CDC are chosen to have breakfast with the director of CDC to discuss ideas. I was able to introduce the idea of a bioinformatics internship program with the director. Since then, several higher-level committees have been discussing how best to implement an internship program with several universities such as GA Tech. This eventually culminated, driven by higher-ups at CDC and not driven by me, into a bioinformatics fellowship under APHL.

Certificate of Appreciation (2011)

Given to the MenAfriVac Development and Implementation Group. This is a major group for the virtual elimination of meningococcal A disease in Africa.

Partners in Public Health Improvement Award (2009)

Given by CDC to a team of collaborators who improve upon a public health initiative. I was a graduate student in the Jordan lab, collaborating with the Meningitis Laboratory at CDC.

Grant for Research Dissertation, CDC (2008)

A grant to fund my dissertation. Microbial Genome Informatics Platform. a Computational Resource for Computational Genomics. (1R36GD000075-01) ($37,386).

Publications

These are my selected publications

  • Katz LS, et al Draft Genome Sequence of Environmental Vibrio cholerae 2012EL-1759 with Similarities to the V. cholerae O1 Classical Biotype Genome Announcements (2014)
  • Katz LS, et al Evolutionary dynamics of Vibrio cholerae O1 following a single source introduction in Haiti Mbio (2013)
  • Katz LS, et al Neisseria Base: a comparative genomics database for Neisseria meningitidis The Journal of Biological Databases and Curation (2011)
  • Katz LS, et al Using SNPs to Discriminate Virulent from Carriage Genomes of Neisseria meningitidis Journal of Bacteriology (2011)
  • Katz LS, et al Nucleic Acids Research 37:Web Server Issue (2009)
  • Skills & Proficiency

    perl

    rust

    Web (HTML/JS/CSS/PHP)

    python

    R