11 minute read

I have talked a bit about hashes with MLST but one crucial issue with hashes is whether they have collisions. In other words, if we have two sequences, there is a chance although usually a very small chance that they could have the same hashsum. In an MLST database, this could mean that the distance between any two samples could be smaller than expected: a pair of allele sequences with the same hash could actually be different even though the hashsum is the same.

First experiment: original databasesPermalink

In reality this is a very small happenstance… but how small? I wanted to see if I could observe it with an in silico experiment:

  1. Download a large MLST database full of alleles
  2. Hashsum all the alleles
  3. Detect whether we see any hashsum more than once.

With my first experiment, I downloaded all ten large databases from chewbbaca.online that were available at the time. I hashed all alleles using perl, using a few popular algorithms

for i in ~/GWA/projects/validation/mlstComparison/MLST.db/*.chewbbaca; do 
  # Ensure all fasta entries are in a two-line-per-entry format and then send them to perl in a tab-separated format of >define \t sequence
  seqtk seq -l 0 <(cat $i/*.fasta) | \
  paste - - | \
  perl -MDigest::MD5=md5_base64 -MDigest::SHA=sha1_base64,sha256_base64 -MString::CRC32=crc32 -lane '
    # Skip if we have seen this sequence already in nucleotide format (it isn't in a hash format yet)
    next if($seen{$F[1]}++); 
    # Print the defline, sequence, and hashsums
    print join("\t", $F[0], $F[1], md5_base64($F[1]), sha1_base64($F[1]), sha256_base64($F[1]), crc32($F[1]));
  ' | \
  gzip -c > t/$(basename $i .chewbbaca).hashes.tsv.gz & done

Next, I systematically looked at each column to see if there were duplicates for any scheme. There were no collisions for SHA1, SHA256, or MD5. However, I did find collisions with CRC32. The number of hashsums that were found at least twice were:

  • Acinetobacter baumanii had 49 duplicated CRC32 hashes
  • Arcobacter butzleri - 3
  • Brucella melitensis - no duplicated CRC32 hashes
  • Campylobacter jejuni - 11
  • Escherichia coli - 1069
  • Listeria monocytogenes - 12
  • Salmonella enterica (the largest database) - 938
  • Streptococcus agalactiae - 11
  • Streptococcus pyogenes - 17
  • Yersinia enterocolitica - Just 1

I wondered also if we could sidestep the issue by seeing if the hashsums were at least unique within a locus. In this circumstance, I did not find any hashsum collisions.

Second experiment: expanded databasePermalink

Ok so we seem good so far with using hashsums, especially MD5, SHA1, or SHA256. But what if we expanded the database. In reality, we are going to find new alleles. Therefore, I introduced random mutations for each allele tenfold, thereby creating databases 11x the original size.

for i in ~/GWA/projects/validation/mlstComparison/MLST.db/*.chewbbaca; do
  seqtk seq -l 0 <(cat $i/*.fasta) | \
  paste - - | \
  perl -MDigest::MD5=md5_base64 -MDigest::SHA=sha1_base64,sha256_base64 -MString::CRC32=crc32 -lane '
    BEGIN{@NT=qw(A C G T);} 
    next if($seen{$F[1]}++); 
    # Do this 11 times, but one of them will have no mutation
    for my $i(1..11){ 
      $seq=$F[1]; 
      # Don't even bother mutating this allele if we've seen it before
      next if($seen{$seq}++); 
      if($i != 1) {
        substr($seq,rand(length($seq)),1) = $NT[rand(4)];
      } 
      # Don't bother using this mutation of an allele if we've seen it before
      next if($seen{$seq}++); 
      # Print the ID, sequence, hashsums
      print join("\t", $F[0], $seq, md5_base64($seq), sha1_base64($seq), sha256_base64($seq), crc32($seq));
    }
  ' | gzip -c > mutations/$(basename $i .chewbbaca).hashes.tsv.gz & done

At this point, I had a spreadsheet similar to experiment 1, but it was much much larger. Here are the number of alleles after attempting to increase the database 10x but skipping over any duplicate DNA sequence.

$ for i in *.tsv.gz; do echo -ne "$i\t"; zcat $i | wc -l; done;
Acinetobacter_baumannii.hashes.tsv.gz   5244059
Arcobacter_butzleri.hashes.tsv.gz       613209
Brucella_melitensis.hashes.tsv.gz       83958
Campylobacter_jejuni.hashes.tsv.gz      2273102
Escherichia_coli.hashes.tsv.gz          22182678
Listeria_monocytogenes.hashes.tsv.gz    2797807
Salmonella_enterica.hashes.tsv.gz       21647330
Streptococcus_agalactiae.hashes.tsv.gz  1829511
Streptococcus_pyogenes.hashes.tsv.gz    2776379
Yersinia_enterocolitica.hashes.tsv.gz   1155678

E.g., 22M alleles across all loci in the E. coli scheme.

Just like the previous method, I looked to see if there were any collisions. I won’t go over the actual numbers again for brevity but you can see them here. The bottom line is that there were many collisions with CRC32 but none with the other algorithms.

I wondered also if 11x was enough because there could be loci with just a ton of alleles, beyond what I imagined. Therefore, I made a histogram of alleles per locus in the 11x databases. Here are just a few for brevity but here are the raw data.

Listeria monocytogenes0100020003000400050006000Count per locus10009008007006005004003002001000Frequency
Escherichia coli0100020003000400050006000700080009000100001100012000130001400015000160001700018000190002000021000Count per locus3500300025002000150010005000Frequency
Salmonella enterica0100020003000400050006000700080009000100001100012000130001400015000Count per locus40003500300025002000150010005000Frequency

So it does look like I might need to look at expanding my view for a very mutated locus if some loci have thousands of alleles.

Experiment 3: mutating a single locus ad nauseamPermalink

I took a specific locus that had about average length INNUENDO_wgMLST-00021749 and wanted to mutate it until I found a collision.

I introduced one to five SNPs (five entries per repetition) for 10^7 repetitions. This would give me up to 5 x 10^7 entries for a single locus of similar sequences.

seq="ATGAGCACCGTGACTATTACCGATTTAGCGCGTGAAAACGTCCGCAACCTGACACCGTATCAGTCAGCGCGTCGTCTGGGTGGTAACGGCGATGTCTGGCTGAACGCCAACGAATACCCCTCTGCCGTGGAGTTTCAGCTTACTCAGCAAACGCTCAACCGCTACCCGGAATGCCAGCCGAAAGCGGTGATTGAAAATTACGCGCAATATGCAGGCGTAAAACCGGAACAGGTGCTGGTCAGCCGTGGCGCGGACGAAGGTATTGAACTACTGATTCGCGCTTTTTGCGAACCGGGTAAAGACGCCATCCTCTACTGCCCGCCAACGTACGGCATGTACAGCGTCAGCGCCGAAACCATTGGCGTCAAGTGCCGCACAGTGCCGACGCTGGAAAACTGGCAACTGGACTTACAGGGCATTTCCGACAAGCTGGACGGCGTAAAAGTGGTCTATGTTTGCAGCCCCAACAACCCAACCGGGCAACTGATCAATCCGCAGGATTTTCGCACTCTGCTGGAGTTAACGCGCGGTAAGGCGATTGTGGTTGCCGATGAAGCCTATATTGAGTTTTGCCCGCAGGCCTCGCTGGCGAGCTGGCTGGCGGAATATCCGCACCTGGCTATTTTGCGCACACTTTCGAAAGCTTTTGCTCTGGCGGGGCTTCGTTGCGGATTTACGCTGGCAAACGAAGAGGTCATCAACCTGCTGATGAAAGTGATCGCCCCCTACCCGCTCTCGACGCCGGTTGCCGACATTGCGGCCCAGGCGTTAAGCCCGCAGGGAATCGTCGCTATGCGCGAACGAGTGACGCAAATTATTGCAGAACGCGAATACCTGATTGCCGCACTGAAAGAGATCCCCTGCGTAGAGCAGGTTTTCGACTCCGAAACCAACTACATTCTGGCGCGCTTTAAAGCCTCCAGCGCAGTGTTTAAATCTTTGTGGGATCAGGGCATTATCTTACGTGATCAGAATAAACAACCCTCTTTAAGCGGCTGCCTACGAATTACCGTCGGAACCCGTGAAGAAAGCCAGCGCGTCATTGACGCCTTACGTGCGGAGCAAGTTTGA"
perl -MDigest::MD5=md5_base64 -MDigest::SHA=sha1_base64,sha256_base64 -MString::CRC32=crc32 -e ' 
  # Start with a few basic definitions: nucleotide array, base sequence, and sequence length
  BEGIN{
    @NT=qw(A C G T); 
    $base=substr("'$seq'",0,10000); 
    $seqLength=length($base); 
  } 
  # 10^7 repetitions 
  for my $rep(1..1e7){ 
    # Reset what the sequence is back to the base, to keep it similar with the rest of the alleles
    $seq=$base; 
    # Have 5 mutations per replicate including intermediate sequences of 1, 2, 3, 4, or 5 mutations from the base
    for my $numChanges(1..5){ 
      # make a single random mutation
      substr($seq,rand($seqLength),1) = $NT[rand(4)]; 
      # Don't include this sequence if we've seen it before: we are not testing collisions with identical underlying sequences
      next if($seen{$seq}++); 
      # print a tsv of different hashsums
      print join("\t", $seq, crc32($seq), md5_base64($seq), sha1_base64($seq), sha256_base64($seq))."\n"; 
    }
  }' > hashsums.tsv

At the end of this, after skipping over sequences that I had already seen, I got 22018011 variants of this same locus (about 22M).

Again, I found only collisions with CRC32 and not the other hashing algorithms. There were 56646 sets of collisions out of the 22M which gave a 0.257% collision rate for this specific locus.

I looked at a couple of collisions and here is just one example of a CRC32 collision. Very similar sequences.

$ grep 1912652596 hashsums.tsv -m 4
ATGAGCACCGTGACTATTACCGATTTAGCGCGTGAAAACGTCCGCAACCTGACACCGTATCAGTCAGCGCGTCGTCTGGGTGGTAACGGCGATGTCTGGCTGAACGCCAACGAATACCCCTCTGCCGTGGAGTTTCAGCTTACTCAGCAAACGCTCAACCGCTACCCGGAATGCCAGCCGAAAGCGGTGATTGAAAATTACGCGCAATATGCAGGCGTAAAACCGGAACAGGTGCTGGTCAGCCGTGGCGCGGACGAAGGTATTGAACTACTGATTCGCGCTTTTTGCGAACCGGGTAAAGACGCCATCCTCTACTGCCCGCCAACGTACGGCATGTACAGCGTCAGCGCCGAAACCATTGGCGTCAAGTGCCGCACAGTGCCGACGCTGGAAAACTGGCAACTGGACTTACAGGGCATTTCCGACAAGCTGGACGGCGTAAAAGTGGTCTATGTTTGCAGCCCCAACAATCCAACCGGGCAACTGATCAATCCGCAGGATTTTCGCACTCTGCTGGAGTTAACGCGCGGTAAGGCGATTGTGGTTGCCGATGAAGCCTATATTGAGTTTTGCCCGCAGGCCTCGCTGGCGAGCTGGCTGGCGGAATATCCGCACCTGGCTATTTTGCGCACACTTTCGAAAGCTTTTGCTCTGGCGGGGCTTCGTTGCGGATTTACGCTGGCAAACGAAGAGGTCATCAACCTGCTGATGAAAGTGATCGCCCCCTACCCGCTCTCGACGCCGGTTGCCGACATTGCGGCCCAGGCGTTAAGCCCGCAGGGAGTCGTCGCTATGCGCGAACGAGTGACGCAAATTATTGCAGAACGCGAATACCTGATTGCCGCACTGAAAGAGATCCCCTGCGTAGAGCAGGTTTTCGACTCCGAAACCAACTACATTCTGGCGCGCTTTAAAGCCTCCAGCGCAGTGTTTAAATCTTTGTGGGATCAGGGCATTATCTTACGTGATCAGAATAAACAACCCTCTTTAAGCGGCTGCCTACGAATTACCGTCGGAACCCGTGAAGAAAGCCAGCGCGTCATTGACGCTTTACGTGCGGAGCAAGTTTGA     1912652596      OLjbYkT1IXdeYNP4ZDgmsw  A51XRiFrNEjLUnlt6rkRmFijmP0     utqm7Qz+q9frx23XPH+HCPqwaBXIx02SB10vszQHQfQ
ATGAGCACCGTGACTATTACCGATTTAGCGCGTGAAAACGTCCGCAACCTGACACCGTATCAGTCAGCGCGTCGTCTGGGTGGTAACGGCGATGTCTGGCTGAACGCCAACGAATACCCCTCTGCCGTGGAGTTTCAGCTTACTCAGCAAACGCTCAACCGCTACCCGGAATGCCAGCCGAAAGCGGTGATTGAAAATTACGCGCAATATGCAGGCGTAAAACCGGAACAGGTGCTGGTCAGCCGTGGCGCGGACGAAGGTATTGAACTACTGATTCGCGCTTTTTGCGAACCGGGTGAAGACGCCATCCTCTACTGCCCGCCAACGTACGGCATGTACAGCGTCAGCGCCGAAACCATTGGCGTCAAGTGCCGCACAGTGCCGACGCTGGAAAACTGGCAACTGGACTTACAGGGCATTTCCGACAAGCTGGACGGCGTAAAAGTGGTCTATGTTTGCAGCCCCAACAACCCAACCGGGCAACTGATCAATCCGCAGGATTTTCGCACTCTGCTGGAGTTAACGCGCGGTAAGGCGATTGTGGTTGCCGATGAAGCCTATATTGAGTTTTGCCCGCAGGCCTCGCTGGCGAGCTGGCTGGCGGAATATCCGCACCTGTCTATTTTGCGCACACTTTCGAAAGCTTTTGCTCTGGCGGGGCTTCGTTGCGGATTTACGCTGGCAAACGAAGAGGTCATCAACCTGCTGATGAAAGTGATCGCCCCCTACCCGCTCTCGACGCCGGTTGCCGACATTGCGGCCCAGGCGTTAAGCCCGCAGGGAATCGTCGCTATGCGCGAACGAGTGACGCAAATTATTGCAGAACGCGAATACCTGATTGCCGCACTGAGAGAGATCCCCTGCGTAGAGCAGGTTTTCGACTCCGAAACCAACTACATTCTGGCGCGCTTTAAAGCCTCCAGCGCAGTGTTTAAATCTTTGTGGGATCAGGGCATTATCTTACGTGATCAGAATAAACAACCCTCTTTAAGCGGCTGCCTACGAATTACAGTCGGAACCCGTGAAGAAAGCCAGCGCGTCATTGACGCCTTACGTGCGGAGCAAGTTTGA     1912652596      aC5DIgAmzozqoP4gPn0lTw  I+VqPf3mYGf3TkIP1pgKpv82p8Y     RZFOWEaSD1W9GKZZKmBavXXVPBu7z0yLkjSOisEXMss
ATGAGCACCGTGACTATTACCGATTTAGCGCGTGAAAACGTCCGCAACCTGACACCGTATCAGTCAGCGCGTCGTCTGGGTGGTAACGGCGATGTCTGGCTGAACGCCAACGAATACCCCTCTGCCGTGGAGTTTCAGCTTACTCAGCAAACGCTCAACCGCTACCCGGAATGCCAGCCGAAAGCGGTGATTGAAAATTACGCGCAATATGCAGGCGTAAAACCGGAACAGGTGCTGGTCAGCCGTGGCGCGGACGAAGGTATTGAACTACTGATTCGCGCTTTTTGCGAACCGGGTAAAGACGCCATCCTCTACTGCCCGCCAACGTACGGCATGTACAGCGTCAGCGCCGAAACCATTGGCGTCAAGTGCCGCACAGTGCCGACGCTGGAAAACTGGCAACTGGACTTACAGGGCATTTCCGACAAGCTGGACGGCGTAAAAGTGGTCTATGTTTGCAGCCCCAACAACCCAACCGGGCAACTGATCAATCCGCAGGATTTTCGCACTCTGCTGGAGTTAACGCGCGGTAAGGCGATTGTGGTTGCCGATGAAGCCTATATTGAGTTTTGCCCGCAGGCCTCGCTGGCGAGCTGGCTGGCGGAATATCCGCACCTGGCTATTTTGCGCACACTTTCGAAAGCTTTTGCTCTGGCGGGGCTTCGTTGCGGATTTACGCTGGCAAACGAAGAGGTCATCAACCTGCTGATGAAAGTGATCGCCCCCTACCCGCTCTCGACGCCGGTTGCCGACATTGCGGCCCAGGCGTTAAGCCCGCAGGGAATCGTCGCTATGCGCGAACGAGTGACGCAAATTATTGCAGAACGCGAATACCTGATTGCCGCACTGAAAGATATCCCCTGCGTAGAGCAGGTTTTCGACTCCGAAACCAACTACATTCTGGCGCGCTTTAAAGCCTCCAGCGCAGTGTTTAAATCTTTGTGGGATCAGGGCATTATCTTACGCGATCAGAATAAACAACCCTCTTTAAGCGGCTGCCTACGAATTACCGTCGGAACCCGTGAAGAAAGCCAGCGCGTCATTGACGCCTTACGTGCGGAGCAAGTTTGA     1912652596      uyUrAnl6SCZSn6wKXwEKyg  n8mi7pMHXWOJ9gytMT8v5v/PvIs     tNISCfLLESwdyzsTczrV7sWpaV/AMQK374xMd9G1XX4
ATGAGCACCGTGACTATTACCGATTTAGCGCGTGAAAACGTCCGCAACCTGACACCGTATCAGTCAGCGCGTCGTCTGGGTGGTAACGGCGATGTCTGGCTGAACGCCAACGAATACCCCTCTGCCGTGGAGTTTCAGCTTACTCAGCAAACGCTCAACCGCTACCCGGAATGCCAGCCGAAAGCGGTGATTGAAAATTACGCGCAATATGCAGGCGTAAAACCGGAACAGGTGCTGGTCAGCCGTGGCGCGGACCAAGGTATTGAACTACTGATTCGCGCTTTTTGCGAACCCGGTAAAGACGCCATCCTCTACTGCCCGCCAACGTACGGCATGTACAGCGTCAGCGCCGAAACCATTGGCGTCAAGTGCCGCACAGTGCCGACGCTGGAAAACTGGCAACTGGACTTACAGGGCATTTCCGACAAGCTGGACGGCGTAAAAGTGGTCTATGTTTGCAGCCCCAACAACCCAACCGGGCAACTGATCAATCCGCAGGATTTTCGCACTCTGCTGGAGTTAACGCGCGGTAAGGCGATTGTGGTTGCCGATGAAGCCTATATTGAGTTTTGCCCGCAGGCCTCGCTGGCGAGCTGGCTGGCGGAATATCCGCACCTGGCTATTTTGCGCACACTTTCGAAAGCTTTTGCTCTGGCGGGGCTTCGTTGCGGATTTACGCTGGCAAACGAAGAGGTCATCAACCTGCTGATGAAAGTGATCGCCCCCTACCCGCTCTCGACGCCGGTTGCCGACATTGCGGCCCAGGCGTTAAGCCCGCAGGGAATCGTCGCTATGCGCGAACGAGTGACGCAAATTATTGCAGAACGCGAATACCTGATTGCCGCACTGAAAGAGATCCCCTGCGTAGAGCAGGTTTTCGACTCCGAAACCAACTACATTCTGGCGCGCTTTAAAGCCTCCAGCGCAGTGTTTAAATCTTTGTGGGATCAGGGCATTATCTTACGTGATCAGAATAAACAACCCTCTTTAAGCGGCTGCCTATGAATTACCGTCGGAACCCGTGAAGAAAGCCAGCGCGTCATTGACGCCTTACGTGCGGAGCAAGTTTGA 1912652596      /RT87qxo5EzQFwrac12uCg  ix/VY90R+VjAzR8xf4cvC+iD8DY     8hdwIeTPUHm1A4XC1C5QTk5ITmXWys8VzVOReh9Ymiw

Experiment 4: simulating the data according to a modelPermalink

With the above graphs showing that the most alleles we see right now per locus is at 4k or 5k, I decided to create 50k alleles per locus from the Salmonella database. The best way to do this in my opinion was with seq-gen, a 28-year old C program that simulates sequences, given a model, a tree, and a reference sequence.

I had to make new scripts and a virtual environment to keep track of it all: https://github.com/lskatz/mlst-hash-experiment.

To make this easier, I just made the actual sequences first before hashing them. I got a little impatient simulating 3002 loci and so I gave it 24 CPUs.

\ls $DBS/Salmonella.chewbbaca/*.fasta | \
  xargs -n 1 -P 24 bash -c '
    b=$(basename $0); 
    if [ -e "mutations-real/$b.txt" ]; then exit; fi; 
    echo "Analyze $0" >&2; 
    perl scripts/make-real-mutations.pl --sequences 50000 $0 --tempdir blah > mutations-real/$b.txt 2> mutations-real/$b.log
  '

At the end of this, I had one file per locus in mutations-real/*.txt, with one allele per line. I wanted to compute the hashsums and so I created a monster one liner. I also introduced a new hashsum based on MD5 that reduces it to 56 bits. I wanted to see if I could reduce the bits and still avoid collisions.

cd mutations-real
for i in *.fasta.txt; do 
  out="$i.qsub.hashsums.tsv.gz"; 
  if [ -e $out ]; then 
    echo "FOUND/SKIP: $out"; 
    continue; 
  fi; 
  echo "
    echo $i; 
    perl ../scripts/make-hashsums.pl < $i | \
      sed 's/^/$i\t/' | \
      gzip -c > $out.tmp && \
      mv $out.tmp $out
    " | qsub -cwd -V -N "hashsums_$i" -pe smp 1 -o $i.qsub.hashsums.log -j y;
  sleep 1; 
  done

Now there was a tsv of: filename, sequence, crc32, md5, md5_56, sha1, and sha256. To test for collisions, I ran this other one-liner. Note that it encodes for field 2 (crc32) in this example. I ran this for each hashsum field.

(set -e; 
  for i in *.hashsums.tsv.gz; do 
    b=$(basename $i .hashsums.tsv.gz); 
    for field in {2..7}; do 
      out="$b.$field.dups.tsv.gz"; 
      echo "Dups to $out"; 
      zcat $i | perl -lane '
        my($file, $seq, $hashsum) = @F[0,1,'$field']; 
        next if($seen{$file}{$seq}++);
        push(@{ $dup{$file}{$hashsum}}, $seq);
        END{
          print STDERR "Found hashsums from ".scalar(keys(%dup))." files.";
          %seen=(); # clear some memory
          print STDERR "Printing any duplicates";
          while(my($file, $hashes)=each(%dup)){
            while(my($hash, $seqs)=each(%$hashes)){
              next if(@$seqs < 2);
              print join("\t", $file, $hash, @$seqs);
            }
          }
        }
      ' | gzip -c > $out; 
    done; 
  done
)

This creates files hash collisions in the format of file, hash, and sequences. The sequences are tab delimited too and so there is no fixed number of columns. The filename is locus.fieldIndex.dups.tsv.gz.

With duplicates in dups.tsv.gz, I could make a multiple sequence alignment of any collision with:

Next I wanted to see an alignment of each hash collision’s underlying sequences.

find . -maxdepth 1 -size +100c -name '*.dups.tsv.gz' | \
  while read file; do 
    echo $file >&2; 
    zcat $file | \
      perl -lane '
        ($file, $hashsum) = splice(@F, 0, 2);
        for(my $i=0;$i<@F;$i++){
          $j=$i+1;
          print ">$j\n$F[$i]";
        }
        # TODO look at more than one collision per locus
        last;
      ' | \
      mafft - 2>/dev/null > $file.collisions.aln.tmp && mv $file.collisions.aln.tmp $file.collisions.aln ; 
  done

Now the question is whether we are looking at very similar loci or not. For that, I used goalign stats to get the percent identity for any given MSA.

\ls *.collisions.aln | \
  xargs -n 1 bash -c '
    cat $0 | goalign stats | grep avgalleles' | \
    xargs -L 1 bash -c 'echo "1/$1" | bc -l' | \
    datamash mean 1 sstdev 1 min 1 max 1

which gives 0.79 ± 0.087 with a minimum/maxiumum of 0.62 - 0.95. So there certainly are very similar alleles within a given locus with hash collisions! There were zero collisions shown in *[3-7].dups.tsv.gz which means that all collisions occured with CRC32 and not even with the derived md5sums.

Which were some of the highest identity alignments (loci) with hashsum collisions? I ran the following to find out.

\ls *.collisions.aln | xargs -n 1 bash -c 'cat $0 | goalign stats | grep avgalleles | sed "s/$/\t$0/"' | sort -k 2,2n | head

avgalleles      1.0503  SALM_14971.fasta.txt.qsub.2.dups.tsv.gz.collisions.aln
avgalleles      1.0525  SALM_16985.fasta.txt.qsub.2.dups.tsv.gz.collisions.aln
avgalleles      1.0549  SALM_18536.fasta.txt.qsub.2.dups.tsv.gz.collisions.aln
avgalleles      1.0555  SALM_15748.fasta.txt.qsub.2.dups.tsv.gz.collisions.aln
avgalleles      1.0558  SALM_18922.fasta.txt.qsub.2.dups.tsv.gz.collisions.aln
avgalleles      1.0570  SALM_18035.fasta.txt.qsub.2.dups.tsv.gz.collisions.aln
avgalleles      1.0581  SALM_16913.fasta.txt.qsub.2.dups.tsv.gz.collisions.aln
avgalleles      1.0614  SALM_18716.fasta.txt.qsub.2.dups.tsv.gz.collisions.aln
avgalleles      1.0626  SALM_15941.fasta.txt.qsub.2.dups.tsv.gz.collisions.aln
avgalleles      1.0628  SALM_15892.fasta.txt.qsub.2.dups.tsv.gz.collisions.aln

The middle column is the number of changes per site in the alignment (1/percent difference). So let’s see the most identical one and how similar it is.

cat SALM_14971.fasta.txt.qsub.2.dups.tsv.gz.collisions.aln | goalign reformat clustal | head -n 5
CLUSTAL W (goalign version 0.3.7)

1   gcgcaaaatcatacatgttgatatggactgtttttttgccgcggtagagg 50
2   gcgcaaaatcatacatgttgctacggactgtttttttgccgcggtagaga 50
    ******************** ** *************************

cat SALM_14971.fasta.txt.qsub.2.dups.tsv.gz.collisions.aln | goalign reformat clustal | tail -n 7
1   cacgtaacgctgcacgaccctcagttggaacgacagttgatgttagggtt 1050
2   cacgtaacgccgctcgaccctcagttggaacgacagttggtgttagggtt 1050
    ********** ** ************************* **********

1   ataa 1054
2   acaa 1054
    * **

Yikes that is very similar. But is it legitimate if the stop codon was mutated to something else? Well it is a simulation but we can find intact stop codons in some of the other alignments, e.g.,

$ cat SALM_16985.fasta.txt.qsub.2.dups.tsv.gz.collisions.aln | goalign reformat clustal | tail -n 7
1   ctggaggatatttgtctgcgcagtaacccacgcaccgccacacaggcaca 1150
2   ctagaggatatttgtctgcgcagtaacccacgcaccgccacacaggcaca 1150
    ** ***********************************************

1   gattatcgccctgtacgcggctaccgggtaa 1181
2   gattatcgacctgtacgcggctgccgggtaa 1181
    ******** ************* ********

Rate of collisions in the Salmonella databasePermalink

Now that we see some collisions within each locus from experiment 4, I wanted to see what the rate of collsions actually was. To do that, I calculated a simple ratio of the number of collisions divided by the the number of alleles created.

Here are the number of collisions. Reminder, this is just the number of alleles that collide within a locus.

zcat *.dups.tsv.gz | wc -l
865

865 collisions.

The number of alleles wasn’t simply 50k times the number of loci. A relative number of loci crashed in the course of this experiment which I did not go back to correct.

cat *.fasta.txt | wc -l
145700000

Ok so plugging into the formula 865/145700000 gives me 0.00000594 (5.94x10^-6), or 0.000594%.

ConclusionsPermalink

I feel like I have at least shown myself that CRC32 is an algorithm to avoid with MLST hashes. At least for myself, I have shown that MD5, 56-byte MD5, SHA1, and SHA256 are strong enough to avoid collisions with MLST. If you do use CRC32, it looks like, at least in one measurement, the rate of collision exists but it is very small. Therefore it would be possible to apply a small correction to each distance of 0.00000594.

AcknowledgementsPermalink

Thank you to Joe Wirth and Joao Carrico for reviewing early drafts and providing feedback. The findings and conclusions are those of the author and do not necessarily represent the official position of the Centers for Disease Control and Prevention.